← BioTransfer GEO Dataset Finder
GEO series

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

GSE225822 Homo sapiens Expression profiling by high throughput sequencing 8 samples Submitted 2024/08/27 Platform GPL28038
Summary
Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.
Published in
ALDH1A1 promotes immune escape of tumor cells through ZBTB7B-glycolysis pathway
Wang M, Wang T, Wang J et al. · Cell death & disease 2024 · PMID 39107297 · doi:10.1038/s41419-024-06943-9
This dataset
Download

Direct links to NCBI, no account and no request form: the whole study as GSE225822_RAW.tar, processed values as the series matrix, the supplementary file directory, and per-sample supplementary files for any of the 8 samples. Raw sequencing reads are also available from ENA.

Also filed as BioProject PRJNA937679 and SRA study SRP423932. Searching any of these in the dataset finder brings you back here.

Samples in this study

The sample list for this study is not cached yet. Press Sort into groups and it will be fetched from NCBI.

+ 8 more — browse all 8 samples with per-sample file links →

Similar datasets

Search all human RNA-seq datasets in GEO →

Share this dataset

Metadata from NCBI GEO, cached and refreshed periodically — the NCBI page above is authoritative. Downloads link straight to NCBI/ENA; nothing is proxied through BioTransfer.