← BioTransfer GEO Dataset Finder
GEO series

Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.

GSE299191 Homo sapiens Genome binding/occupancy profiling by high throughput sequencing 4 samples Submitted 2025/12/09 Platform GPL24676
Summary
KDM5A-KO HEK293T cells were purchased from Beyotime (Shanghai, China). These KDM5A-KO HEK293T cells are polyclonal cells infected with lentivirus expressing the single guide RNA (sgRNA) and Cas9 and containing a puromycin resistance cassette and were characterized via a T7EI assay. The sgRNA sequence used to generate the KDM5A-KO cells was TCTCCGCCAAAGGCCGGATG. The sequences of the PCR primers specific for KDM5A were as follows: forwards, 5’CTTCAGCCAGCTTTTCTCCA3’; and reverse, 5’TCAGTTCCCAAGTTCTAGGC3’. H3k4me3(CST) cut&tag was performed for further analysis.
Published in
Loss of KDM5A-mediated H3K4me3 demethylation promotes aberrant neural development by Wnt/β-catenin pathway activation
Li J, Liang Y, Cao Z et al. · Cell death & disease 2025 · PMID 41266313 · doi:10.1038/s41419-025-08208-5
This dataset
Download

Direct links to NCBI, no account and no request form: the whole study as GSE299191_RAW.tar, processed values as the series matrix, the supplementary file directory, and per-sample supplementary files for any of the 4 samples. Raw sequencing reads are also available from ENA.

Also filed as BioProject PRJNA1273051 and SRA study SRP590499. Searching any of these in the dataset finder brings you back here.

Samples in this study

The sample list for this study is not cached yet. Press Sort into groups and it will be fetched from NCBI.

+ 4 more — browse all 4 samples with per-sample file links →

Similar datasets

Search all human ChIP / ATAC / CUT&Tag datasets in GEO →

Share this dataset

Metadata from NCBI GEO, cached and refreshed periodically — the NCBI page above is authoritative. Downloads link straight to NCBI/ENA; nothing is proxied through BioTransfer.