← BioTransfer GEO Dataset Finder
GEO series

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

GSE290209 Homo sapiens Expression profiling by high throughput sequencing 6 samples Submitted 2025/02/21 Platform GPL24676
Summary
Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
Published in
Zinc finger protein ZC3H18 is abnormally expressed in esophageal cancer tissues and facilitates the proliferation of esophageal cancer cells
Zhang Y, Wan Y, Li J et al. · Frontiers in immunology 2025 · PMID 40070828 · doi:10.3389/fimmu.2025.1556509
This dataset
Download

Direct links to NCBI, no account and no request form: the whole study as GSE290209_RAW.tar, processed values as the series matrix, the supplementary file directory, and per-sample supplementary files for any of the 6 samples. Raw sequencing reads are also available from ENA.

Also filed as BioProject PRJNA1226578 and SRA study SRP565585. Searching any of these in the dataset finder brings you back here.

Samples in this study

The sample list for this study is not cached yet. Press Sort into groups and it will be fetched from NCBI.

+ 6 more — browse all 6 samples with per-sample file links →

Similar datasets

Search all human RNA-seq datasets in GEO →

Share this dataset

Metadata from NCBI GEO, cached and refreshed periodically — the NCBI page above is authoritative. Downloads link straight to NCBI/ENA; nothing is proxied through BioTransfer.