← BioTransfer GEO Dataset Finder
GEO series

Effect of HIF-1alpha knockout in gene expression profile of osteosarcoma cells in vivo.

GSE307480 Mus musculus Expression profiling by high throughput sequencing 4 samples Submitted 2026/01/04 Platform GPL34290
Summary
To explore in vivo changes in gene expression of osteosarcoma cells upon depletion of HIF-1alpha we performed RNAseq analysis using Mock control AXT cells and HIF-1alpha KO AXT cells. HIF1alpha was knocked out using CRISPR-Cas9 with two different target sequences. KO1-1 and KO1-2 cells are derived from target sequence#1:5’- AGATGTGAGCTCACATTGTGGGG -3’ (exon3) and KO2 cells are from #2:5’-GCTAACAGATGACGGCGACATGG-3’ (exon5). AXT cells were established from BMSCs of Ink4a/Arf null mouse by overexpressing human c-MYC (Shimizu T, et al. Oncogene, 2010).
Published in
Depleting HIF‑1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF‑independent pathways
Kunishima A, Shimizu T, Takimoto T et al. · Oncology reports 2026 · PMID 41823542 · doi:10.3892/or.2026.9099
This dataset
Download

Direct links to NCBI, no account and no request form: the whole study as GSE307480_RAW.tar, processed values as the series matrix, the supplementary file directory, and per-sample supplementary files for any of the 4 samples. Raw sequencing reads are also available from ENA.

Also filed as BioProject PRJNA1321816 and SRA study SRP618386. Searching any of these in the dataset finder brings you back here.

Samples in this study

The sample list for this study is not cached yet. Press Sort into groups and it will be fetched from NCBI.

+ 4 more — browse all 4 samples with per-sample file links →

Similar datasets

Search all mouse RNA-seq datasets in GEO →

Share this dataset

Metadata from NCBI GEO, cached and refreshed periodically — the NCBI page above is authoritative. Downloads link straight to NCBI/ENA; nothing is proxied through BioTransfer.